Machine-learning intervention progress in the field of organic waste composting: Simulation, prediction, optimization, and challenges.

Aerobic composting stands as a widely-adopted method for treating organic solid waste (OSW), simultaneously producing organic fertilizers and soil amendments. This biologically-driven biochemical reaction process, however, presents challenges due to its complex non-linear metabolism and the heterogeneous nature of the solid medium. These characteristics inherently limit the simulation accuracy and efficiency optimization in aerobic composting. Recently, significant efforts have been made to simulate and control composting process parameters, as well as predicting and optimizing composting product quality. Notably, the integration of machine learning (ML) in aerobic composting of organic waste has garnered considerable attention for its applicability and predictive capability in exploring the complex non-linear relationships of organic waste composting parameters. Despite numerous studies on ML applications in OSW composting, a systematic review of research findings in this field is lacking. This study offers a systematic overview of the application level, current status, and versatility of ML in OSW composting. It spans various aspects, such as compost maturity, environmental pollutants, nutrients, moisture, heat loss, and microbial metabolism. The survey reveals that ML-intervention predominantly focuses on compost maturity and environmental pollutants, followed by nutrients, moisture, heat loss, and microbial activity. The most commonly employed predictive models and optimization algorithms are artificial neural networks (47%) and genetic algorithms (10%). These demonstrate high prediction accuracy and maximize composting efficiency in the simulation and prediction of organic waste composting, alongside regulation of key parameters. Deep neural networks and ensemble learning models prove effective in achieving superior predictive performance by selecting feature variables in compost maturity and pollutant residue prediction of organic waste composting in a simpler and more objective manner.

Novel perspective on qualitative assessment of swine manure compost maturity using organic carbon density fractions.

Mature compost is safe and stable, yet quality assessments are challenging owing to current maturity indicators' limitations. This study employed density fractionation to separate organic carbon into light and heavy fractions, offering a new perspective for assessing maturity. Results showed that light fraction organic carbon progressively transitioned into heavy fraction during composting, reducing the proportion of total organic carbon from 82.82% to 44.03%, while heavy fraction organic carbon increased to 48.58%. During the first seven days, the reduction rate of light fraction organic carbon decreased slowly, while the increase rate of heavy fraction declined sharply, levelling off thereafter. Light/heavy fraction organic carbon ratio was significantly correlated with existing maturity indicators (carbon/nitrogen ratio, humic acid/fulvic acid ratio, biological growth-related indicators), with the ratio below 1.33 serving as a potential compost maturity marker. Thus, given its simplicity and reliability, organic carbon density fractions is an innovative indicator for compost maturity assessments.

Vine tea extract ameliorated acute liver injury by inhibiting hepatic autophagy and reversing abnormal bile acid metabolism.

Gut microbiota disturbance, autophagy dysregulation, and accumulation of hepatic bile acids (BAs) are essential features of liver injury. Therefore, regulating autophagy and BA metabolism are potential strategies for treating liver diseases. Vine tea has been seen beyond a pleasant tea in food science. Our previous study found that vine tea extract (VTE) intervention alleviated acute liver injury (ALI) by restoring gut microbiota dysbiosis. In this study, we aim to investigate the effect of VTE on carbon tetrachloride (CCl4)-induced hepatic autophagy and BA metabolism disorder in mice. The results showed that VTE effectively suppressed CCl4-induced liver fibrosis and hepatic autophagy. LC-MS/MS assay suggested that VTE affected fecal BA production by reducing the fecal BA levels and improving cholestasis in ALI mice. Besides, VTE inhibited BA synthesis, promoted BA transport in the liver, and enhanced BA reabsorption in the ileum through the farnesoid X receptor (FXR)-related signaling pathway. The hepatic expressions of Fxr and Abca1 were elevated by VTE. Finally, the depletion of gut microbiota in ALI mice had a negative impact on abnormal autophagy and BA metabolism. It was also noted that the administration of VTE did not provide any additional improvement in this regard. Overall, VTE ameliorated ALI by reversing hepatic autophagy and abnormal BA metabolism, and the beneficial effects of VTE on liver injury depended on the existence of gut microbiota.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Spatially resolved transcriptomics revealed local invasion-related genes in colorectal cancer.

Objective: Local invasion is the first step of metastasis, the main cause of colorectal cancer (CRC)-related death. Recent studies have revealed extensive intertumoral and intratumoral heterogeneity. Here, we focused on revealing local invasion-related genes in CRC. Methods: We used spatial transcriptomic techniques to study the process of local invasion in four CRC tissues. First, we compared the pre-cancerous, cancer center, and invasive margin in one section (S115) and used pseudo-time analysis to reveal the differentiation trajectories from cancer center to invasive margin. Next, we performed immunohistochemical staining for RPL5, STC1, AKR1B1, CD47, and HLA-A on CRC samples. Moreover, we knocked down AKR1B1 in CRC cell lines and performed CCK-8, wound healing, and transwell assays to assess cell proliferation, migration, and invasion. Results: We demonstrated that 13 genes were overexpressed in invasive clusters, among which the expression of CSTB and TM4SF1 was correlated with poor PFS in CRC patients. The ribosome pathway was increased, while the antigen processing and presentation pathway was decreased along CRC progression. RPL5 was upregulated, while HLA-A was downregulated along cancer invasion in CRC samples. Pseudo-time analysis revealed that STC1, AKR1B1, SIRPA, C4orf3, EDNRA, CES1, PRRX1, EMP1, PPIB, PLTP, SULF2, and EGFL6 were unpregulated along the trajectories. Immunohistochemic3al staining showed the expression of STC1, AKR1B1, and CD47 was increased along cancer invasion in CRC samples. Knockdown of AKR1B1 inhibited CRC cells' proliferation, migration, and invasion. Conclusions: We revealed the spatial heterogeneity within CRC tissues and uncovered some novel genes that were associated with CRC invasion.

Response of occurrence in microplastics and its adsorped cadmium capacity to simulated agricultural environmental scenarios in sludge-amended soil.

Large amounts of microplastics (MPs) enter the soil along with the amendment of sludge to soil. However, it is still unclear about the response of MPs occurrence and the adsorption behaviors of cadmium (Cd)on MPs to typical agricultural environmental scenarios. In present work, three kinds of MPs (polyethylene, polypropylene, and polystyrene) were chosen to investigate that response in three agricultural environmental scenarios with sludge-amended soil, including dry-wet alteration (7 d, five cycles), microbial addition (Bacillus subtilis, 0.05 g/g soil), and Ultraviolet (UV) irradiation (340 nm, 4 × 15 W, 4 d). The results showed that there was the highest adsorption capacity of Cd on MPs (36.21, 45.15, 12.43 µg/g for PE, PP, PS, respectively) after UV irradiation exceeding those from MPs triggered by other two scenarios). UV irradiation caused an increase in the abundance of Streptomyces, an expansion in specific surface area, a significant change in surface morphologies, an improvement in crystallinity or the formation of new crystals, and an enhancement in C-O and CO content, and then resulted in the incremental adsorption capacity of Cd on MPs. The findings are important of significance for controlling the environmental risks from sludge MPs via carrying heavy metals in the soil-plant systems.

Transcriptional regulation of NDUFA4L2 by NFIB induces sorafenib resistance by decreasing reactive oxygen species in hepatocellular carcinoma.

Sorafenib is one a first-line therapeutic drugs for advanced hepatocellular carcinoma (HCC). However, only 30% of patients benefit from sorafenib due to drug resistance. We and other groups have revealed that nuclear factor I B (NFIB) regulates liver regeneration and carcinogenesis, but its role in drug resistance is poorly known. We found that NFIB was more upregulated in sorafenib-resistant SMMC-7721 cells compared to parental cells. NFIB knockdown not only sensitized drug-resistant cells to sorafenib but also inhibited the proliferation and invasion of these cells. Meanwhile, NFIB promoted the proliferation and invasion of HCC cells in vitro and facilitated tumor growth and metastasis in vivo. Knocking down NFIB synergetically inhibited tumor growth with sorafenib. Mechanically, gene expression profiling and subsequent verification experiments proved that NFIB could bind with the promoter region of a complex I inhibitor NDUFA4L2 and promote its transcription. Transcriptional upregulation of NDUFA4L2 by NFIB could thus inhibit the sorafenib-induced reactive oxygen species accumulation. Finally, we found that NFIB was highly expressed in HCC tissues, and high NFIB expression level was associated with macrovascular invasion, advanced tumor stage, and poor prognosis of HCC patients (n = 156). In summary, we demonstrated that NFIB could transcriptionally upregulate NDUFA4L2 to enhance both intrinsic and acquired sorafenib resistance of HCC cells by reducing reactive oxygen species induction.

The prevalence of chronic medication therapy problems and pharmacists' interventions among hospitalized perioperative patients: a retrospective observational study.

BACKGROUND: Inadequate preoperative management of chronic medications can place perioperative patients at risk and cause unnecessary delays in surgical procedures. This study aims to investigate the prevalence of chronic medication therapy problems (CMTPs) in hospitalized perioperative patients and assess the relevance of pharmacists' interventions. METHODS: We conducted a retrospective study of pharmacist-led preoperative management of chronic medications in hospitalized adult patients from November 2018 to April 2019. The recorded drug-related problems (DRPs) were retrospectively reviewed and categorized according to the Pharmaceutical Care Network Europe classification V9.1 and were analyzed with a multinomial regression model to identify risk factors. RESULTS: A total of 254 DRPs were recorded, with an average of 0.52 DRPs per patient. Treatment safety (66.9%) was the most common DRP. The most frequent causes of perioperative DRPs and nonperioperative DRPs were drug selection (72.9%) and patient related (50.8%), respectively. Of the 292 documented interventions, 71.6% were fully accepted by the clinicians and patients. The majority (68.9%) of the recorded problems were completely resolved. The number of comorbidities (OR = 3.815) and the number of chronic medications taken (OR = 1.539) were risk factors for the occurrence of DRPs. CONCLUSION: The findings of this study suggest that pharmacist-led chronic medication therapy management in surgical wards may be an effective method to help reduce medication-related surgical risks and optimize the medication therapies used for the long-term treatment of chronic diseases.

Is elevated triglyceride/high-density lipoprotein cholesterol ratio associated with poor prognosis of coronary heart disease? A meta-analysis of prospective studies.

BACKGROUND: Elevated triglycerides (TG) and reduced high-density lipoprotein cholesterol (HDL-C) are recognized as essential and independent hazard factors for total death and major adverse cardiovascular events (MACE) in patients with coronary heart disease (CHD). However, whether the increased TG/HDL-C forecasted the prognosis of CHD is still unknown. Therefore, we performed a meta-analysis to investigate the relationship between the elevated TG/HDL-C ratio and poor prognosis of CHD. METHODS: A systematic literature search was conducted in PubMed, Web of Science, EMBASE, and The Cochrane Library, until August 30, 2021. Prospective observational studies regarding the association between TG/HDL-C and long-term mortality/MACEs in CHD patients were included. RESULTS: In total, 6 independent prospective studies of 10,222 participants with CHD were enrolled in the systematic and meta-analysis. Our outcomes of the meta-analysis indicated that the elevated TG/HDL-C group had a significantly increased risk of long-term all-cause mortality (hazard ratio [HR] = 2.92, 95% confidence interval [CI]: 1.75-4.86, P < .05) and long-term MACEs (HR = 1.56, 95%CI 1.11-2.18, P < .05). CONCLUSION: In patients with CHD, the present study showed that the high TG/HDL-C was associated with increased risk of long-term all-cause mortality and MACE.

High-Resolution Histopathological Image Classification Model Based on Fused Heterogeneous Networks with Self-Supervised Feature Representation.

Applying machine learning technology to automatic image analysis and auxiliary diagnosis of whole slide image (WSI) may help to improve the efficiency, objectivity, and consistency of pathological diagnosis. Due to its extremely high resolution, it is still a great challenge to directly process WSI through deep neural networks. In this paper, we propose a novel model for the task of classification of WSIs. The model is composed of two parts. The first part is a self-supervised encoding network with a UNet-like architecture. Each patch from a WSI is encoded as a compressed latent representation. These features are placed according to their corresponding patch's original location in WSI, forming a feature cube. The second part is a classification network fused by 4 famous network blocks with heterogeneous architectures, with feature cube as input. Our model effectively expresses the feature and preserves location information of each patch. The fused network integrates heterogeneous features generated by different networks which yields robust classification results. The model is evaluated on two public datasets with comparison to baseline models. The evaluation results show the effectiveness of the proposed model.

Simulation, prediction and optimization of typical heavy metals immobilization in swine manure composting by using machine learning models and genetic algorithm.

Machine learning (ML) is a novel method of data analysis with potential to overcome limitations of traditional composting experiments. In this study, four ML models (multi-layer perceptron regression, support vector regression, decision tree regression, and gradient boosting regression) were integrated with genetic algorithm to predict and optimize heavy metal immobilization during composting. Gradient boosting regression performed best among the four models for predicting both heavy metal bioavailability variations and immobilization. Gradient boosting regression-based feature importance analysis revealed that the heavy metal initial bioavailability factor, total phosphorus, and composting duration were the determinant factors for heavy metal bioavailability variations (together contributing >75%). After genetic algorithm optimization, the maximum immobilization rates of Cu, Zn, Cd, As, and Cr were 79.53, 31.30, 14.91, 46.25, and 66.27%, respectively, superior to over 90% of the measured data. These findings demonstrate the potential application of ML to risk-control for heavy metals in livestock manure composting.

Influence of sludge treatment methods on behaviors of microplastics adsorbed cadmium and its driving factors.

The complicated contamination of microplastics (MPs) and heavy metals in sludge has garnered substantial attention in recent years; however, research on the behavior of MPs loading of heavy metals in sludge after sludge treatment methods is limited. Four representative sludge treatment methods were selected herein: anaerobic digestion, thermal drying, thermal hydrolysis (TH), and aerobic composting. Before and after sludge treatment, the chemical bonding of MPs, cadmium (Cd) adsorption properties, and metabolic changes in the microbial community succession was analyzed, and the factors influencing differences in Cd sorption by sludge MPs were explored. The results revealed that Cd adsorption by MPs occurs as multilayer physical adsorption that can be well fitted by Freundlich isotherms. Compared with the other three treatments, TH led to the most significant effect on the chemical bonding properties of the MPs, with a more than two-fold increase in C-O single bonds and CO double bonds, as well as adsorption of the highest amount of Cd at 767 µg/g. In addition, sludge conductivity and water content also affected Cd sorption capacity, with correlation coefficients of 0.405 and -0.384. Pedobacter, Flavobacterium, Lysobacter, and Sphingobacterium in the sludge presented a high degree of coupling with adsorption capacity, it was inferred that the above dominant species of bacteria may affect the adsorption of Cd by microplastics through the production of extracellular enzyme forms.

Monocyte to high-density lipoprotein ratio predict long-term clinical outcomes in patients with coronary heart disease: A meta-analysis of 9 studies.

BACKGROUND: A novel inflammation-related biomarker, the monocyte to high-density lipoprotein cholesterol ratio (MHR), had a great relation to the development and prognosis of coronary atherosclerotic heart disease. Current study was to investigate whether the MHR was a potential tool in predicting the mortality and major adverse cardiac events (MACEs) in patients suffering coronary heart disease (CHD) by meta-analysis. METHODS: The Cochrane Library, PubMed, MEDLINE, Scopus, EMBASE, and Web of science were searched for relevant cohort studies published prior to February 10, 2022. The association between MHR and mortality/MACEs was analyzed in patients with CHD. Hazard ratios (HR) with 95% confidence interval (CI) were calculated to estimate the strength of association. RESULTS: In the meta-analysis, a total of 9 studies of 11,345 patients with CHD were included. Compared with the low level of MHR group, the high MHR value was associated with higher long-term MACEs (HR = 1.72 95% CI 1.36-2.18, P < .001), long-term mortality (HR = 1.71, 95% CI 1.10-2.66, P = .017), and in-hospital mortality/MACEs (HR = 2.82, 95% CI = 1.07-7.41, P = .036). CONCLUSIONS: This study suggested that increased MHR value might be associated with higher long-term mortality and long-term MACEs in CHD patients. MHR might serve as a potential prognostic indicator for risk stratification in patients with CHD.

Recent advances in the application of machine learning methods to improve identification of the microplastics in environment.

Environmental pollution by microplastics (MPs) is a significant and complex global issue. Existing MPs identification methods have demonstrated significant limitations such as low resolution, long imaging time, and limited particle size analysis. New and improved methods for MPs identification are topical research areas, with machine learning (ML) algorithms proven highly useful in recent years. Critical literature reviews on the latest developments in this area are limited. This study closes this gap and summarizes the progress made over the last 10 years in using ML algorithms for identifying and quantifying MPs. We identified diverse combinations of ML methods and fundamental techniques for MPs identification, such as Fourier-transform infrared spectroscopy, Raman spectroscopy, and near-infrared spectroscopy. The most widely used ML model is the support vector machine, which effectively improves the conventional analysis method for spectral quality defects and improves detection accuracy. Artificial neural network models exhibit improved recognition effects, with shorter detection times and better MPs recognition efficiency. Our review demonstrates the potential of ML in improving the identification and quantification of MPs.

Negative pressure promotes macrophage M1 polarization after Mycobacterium tuberculosis infection via the lncRNA XIST/microRNA-125b-5p/A20/NF-κB axis.

Experiments have demonstrated the regulation of long noncoding RNA (lncRNA) in tuberculosis (TB), and negative pressure treatment has been associated with the alleviation of TB. Here, we investigated the interaction of negative pressure and the lncRNA X-inactive specific transcript (XIST) in modulating Mycobacterium tuberculosis (MTB) infection. Initially, we established an in vitro cell model of MTB infection and an in vivo mouse model of MTB infection, followed by treatment with negative pressure. Then, we examined the expression of XIST, followed by analysis of the downstream miRNA of XIST. XIST was overexpressed or underexpressed through cell transfection to examine its effects on macrophage polarization via the miR-125b-5p/A2 axis. The MTB models were characterized by upregulated XIST and downregulated miR-125b-5p. XIST bound to miR-125b-5p, leading to its downregulation, and thus causing higher MTB survival in an ESAT-6-dependent manner. Additionally, negative pressure treatment decreased MTB-driven XIST expression through downregulation of A20 (an NF-κB repressor) via miR-125b-5 expression, promoting the M1 polarization program in macrophages through activation of the NF-κB pathway. In summary, negative pressure treatment after MTB infection can promote the polarization of macrophages to the proinflammatory M1 phenotype by regulating the XIST/miR-125b-5p/A20/NF-κB axis.

Effects of typical sludge treatment on microplastics in China-Characteristics, abundance and micro-morphological evidence.

Microplastics (MPs) are emerging pollutants that are enriched in sludge. They enter soil through sludge soil amendment, landfill, and discard, which will cause inescapable environmental pollution risks. Sludge treatment technology commonly used in China include anaerobic digestion (AD), thermal drying (TD), thermal hydrolysis (TH) and aerobic composting (AC). In this study, characteristics of MPs in sewage sludge from four representative large cities in China (Zhengzhou, Chongqing, Guangzhou, and Guilin) were analyzed. Effects of four representative sludge treatment technology on sludge MPs were also studied. In addition, the amount of MPs input to soil from sludge in China was estimated. The abundance range of sludge MPs of representative cities in China was 1448-11,125 n∙kg-1 DW. Previous studies indicate that this abundance range is low among other domestic cities and is close to that of European countries. MPs were predominantly fiber-shaped, accounting for 46.66%; 56.5% MPs were white and transparent, and 62.5% were polypropylene and polyethylene. The abundance of MPs in the sludge increased after TH, indicating that MPs broke into smaller particles. However, the other three treatment methods had no significant influence on the abundance of MPs. Scanning electron microscopy analysis showed that the micro-morphology of sludge MPs surface were rougher after AD, and MPs cracked following TD and TH. Furthermore, broken edges were more blurred after TH, and surfaces of MPs were damaged and eroded after AC. The input quantities of MPs in sludge to soil was deduced to be 1013 particles per year. These results are important for controlling the potential risk of sludge MPs in China.

[Effects of GLAST gene knockout on phenotype and hearing in mice].

OBJECTIVE: To investigate the effects of glutamate aspartate transporter (GLAST)deletion on the normal auditory function of mice. METHODS: We hybridized GLAST+/- mice with C57BL/6J background and identified the genotypes of their offspring by agarose gel electrophoresis. 9-10-week-old mice were selected to detect the expression of GLAST protein in the cochlea by immunofluorescence staining and to verify the knockout results(n=3). The changes in weight from 7 days to 30 days after birth and the 30-day body length of male and female mice were compared(n=8). The auditory brainstem response(ABR) was used to detect the auditory threshold and the amplitude of wave I in 9-10-week-old male and female mice(n=5). RESULTS: Male GLAST-/- mice had shown significantly lower weight and body length compared to male GLAST+/+ and GLAST+/- mice(P＜0.01), and male GLAST-/- mice showed significant differences compared to GLAST+/+ from P7 to P30 statistical time. Male GLAST-/- mice exhibited a significant reduction in weight after P15 compared to male GLAST+/- mice. In contrast, no significant differences in weight and body length were observed in female GLAST-/- mice compared with female GLAST+/+ and GLAST+/- mice. There was no difference in the hearing threshold detected by ABR between the three genotypes in both male and female mice, but the amplitude of wave I in GLAST-/- mice was significantly lower than that in male GLAST+/+ mice(P＜0.01). In contrast, the amplitude of wave I in females was reduced throughout the stimulus intensity but was most significant only at high-intensity stimulation (e.g.80 dB, 90 dB) (P＜0.05). CONCLUSION: GLAST knockout affects the normal growth and development of male mice, and decreases the amplitude of wave I, but do not change the threshold, suggesting that GLAST knockout may lead to synaptic pathological changes, and there are gender differences in this effect.

Immobilization pathways of heavy metals in composting: Interactions of microbial community and functional gene under varying C/N ratios and bulking agents.

Excessive heavy metals (HMs) in livestock manure due to additives over-use limits its recycling through composting. However, few studies have investigated the interactive influence of microbial communities, functional genes, and environmental factors in HM immobilization during composting. Therefore, treatments with different C/N ratios (15:1, 20:1, 25:1) and bulking agents (maize straw, green waste, vinasse) were conducted to explore the HMs immobilization pathways using structural equation model (SEM). Results confirmed the promoting effect of C/N ratio of 20:1 and vinasse on microbial diversity, thus leading to greater HMs immobilization rate. Meanwhile, the dominant microbial phyla of Cu/Zn, Cd, As, and Cr were identified as Proteobacteria, Firmicutes, Chytridiomycota, and Bacteroidota, respectively. Moreover, the significant correlation between functional genes (copC, mt, cbh1, aoxB, yieF) and HMs illustrated potential immobilization effects of metal-binding proteins on Cu and Zn, humus complexation on Zn, and oxidase/reductase on As/Cr. Finally, SEM indicated that the redistribution of Cu, Zn, As, and Cr fractions was interactively influenced by environmental factors (organic matter, pH, electrical conductivity, and total phosphorus), microbial communities, and functional genes, while Cd was directly regulated by organic matter and total phosphorus. These results may provide a deeper understanding of HM immobilization pathways during swine manure composting.

Probing changes in humus chemical characteristics in response to biochar addition and varying bulking agents during composting: A holistic multi-evidence-based approach.

Despite the various benefits of humus, the changes in its chemical characteristics during composting in response to biochar addition and varying bulking agents remain to be further explored. In this study, three treatments were conducted, in which swine manure, bulking agent, and biochar were mixed at ratios of 4:1:0, 8:1:0, and 8:1:1. Fourier transform infrared spectroscopy (FTIR), carbon nuclear magnetic resonance spectroscopy (13C-NMR), three-dimensional excitation-emission matrix fluorescence spectroscopy (3D-EEM), and near-edge X-ray absorption fine structure (NEXAFS) were employed to characterize the chemical and structural properties of humus from multiple perspectives. The 3D-EEM spectra in this study showed a larger increase in humic acids (HAs) content (56%) and HAs to fulvic acids ratio (128%) during composting, indicating stronger humification in biochar-amended treatment. FTIR, 13C-NMR, and NEXAFS all confirmed the essential properties of HA as the core agronomic functional substance with rich aromatic and carboxyl groups, and that its aromaticity increased gradually during composting. In addition, 13C-NMR demonstrated that biochar addition and a relatively higher bulking agent ratio aided an increase in the carboxyl C proportion in HA after composting. In particular, NEXAFS revealed that biochar addition promoted the diversification of C, N, and O species in HA, with the emergence of quinone C and O-alkyl C as the main representatives. This work suggests that biochar addition and a relatively high bulking agent ratio could enhance humification and improve the agronomic function of humus.